On the day, to live as the Protagonist, Frédéric Beigbeder, decides that he comes from a hospital visit at the home kitchen table, to his daughter. “Is it true, dad, that everyone dies?”
The author Beigbeder describes his fictional namesake as a man at the peak of his life. 53 years old. A single father, with a “overpaid Job” and a BMW Hybrid. Beigbeder is one of the Stars on TV-the sky of France. His life he lives in excess. In the evening, he sets up for his talk show guests under the drug. Ritalin, methadone, Captagon, Xanax, Synapsyl, Rohypnol, LSD. “Just as it comes.”
In his Show is Beigbeder immortal. His ratings are in the three to four million viewers. Even higher, if Beigbeder is swallowing itself pills and he auskotzt the drug cocktail live on his Blue Suede Shoes . His Aura radiates in the moment shots on the other. The beam power is measured by the number of Selfies with his Fans. In his Facebook Account, he counts all his Fans: “I pose, therefore I am.” With over 100,000 Likes, he gets “a erection”. The death was not yet on Beigbeders Agenda. Die, that was just for “Lazy, only fatalists think death is inevitable”.
“From now on, nobody dies anymore,” he promises his daughter. But can human life away from the flashbulbs just preserve? What a Marathon by hospitals and research laboratories, Harvard Medical School, is as follows, into the East River Lab of New York. Always on the search for eternal life. The “Supermen” that outlasts the Rest of humanity in a Darwinian struggle against old age and disease.
author Frédéric Beigbeder
For Frédéric Beigbeder, it is not the first self-reflexive novel with autobiographical priming. Already in his breakthrough with “39,90” written Marc Marronnier-the trilogy by the main character between drugs and love excesses and lives a life crisis. And once again, the main addictive character in his new title of “Endless the solution to life” in the beginning, in narcissistic Self-contemplation, with Selfies as a status symbol and “proof of identity”. With the journey into the world of medicine, but the identity is unmasked. Self-love develops Beigbeder in his novel-a smart way to Self-destruction.
Behind the pixels are of brain structures not visible
The young Narcissus was said in Greek mythology, a long life ahead of it. The condition: Betsmove He could not recognize himself. Narcissus gazed into water and died. Those self-awareness of one’s own body Beigbeder drives in his novel as a medical meat inspection on the top. Up on a molecular level, he dismembered the main character.
photo
scientists take samples of blood. By ECG Beigbeder leaves his heart rate recording. With a gooey ultrasound probe to examine the prostate. It is a Self-contemplation, which penetrates under the skin surface and the glow of the Show world. The underneath-lying body is translated into immovable mathematical formulas. The pulse is at a high load at 180. His DNA: “ATGCCGC…” 352 variants has to be Code with the Neanderthal mean.
According to the statistics of the time remain Beigbeder 26 years to the death. No longer a Star, but a line in the statistics. The death is complex and well-calculated fractal image: “You will be immersed in a mathematical figure, which is raised to the power of infinity.” DNA can be changed. For Frédéric Beigbeder, this insight is a “narcissistic mortification”.
DISPLAY Frédéric Beigbeder:
Infinite lives
translated from French by Julia Schoch
Piper; 352 pages; 22 Euro
Amazon order. In the case of Thalia order.
understands The more Beigbeder his body in all its complexity, the more difficult the fight against death. In California, research center “Health Nucleus” as he lifted his head with electrodes to the computer tomograph, connect, layer by layer, his brain structures mapping. Behind the pixels of his Selfies, blood vessels, cells, and synapses are visible. And also: fatty liver, high blood pressure. For most of its physical boundaries, the medicine has the answers. Rejuvenation seems to be still impossible.
We must not take every Detail in Beigbeders novel at face value. Supposedly, all the dialogues come, with the physicians and researchers of real-world recordings made by F. B. – the initials of the Preface – in the case of personal searches. Evidence there is no. The DNA Code does not check.
Nevertheless, Beigbeders novel, credible, and relentless, more from a scientific point of view: “You would have to select a different language in order to write the final book: ATGCCGCGCGCTCCCCGCTGCCGAGCCGTGCGCTCCCTGCTGCGCAGCCAC…”
